High-resolution landscape of an antibiotic binding site – Nature

-

[ad_1]

Saturation mutagenesis screening approach

MAGE with the E. coli EcNR2 strain1 was used to generate a pool of single-residue Rif binding site substitutions comprising rpoB 510–537 and 563–572. 760 MAGE oligos (Integrated DNA Technologies) were designed to generate 20 possible single-residue mutants in 38 positions. To limit the detection of background mutations and further increase the specificity of our approach, we specifically designed our MAGE library to produce single codon substitutions that include multiple nucleotide alterations when possible. A single round of MAGE mutagenesis was done in four bins comprising 510–518, 519–527, 528–537 and 563–572. Cells were recovered overnight and stocked in glycerol.

To begin a screening experiment, cells were thawed, bins were combined and allowed to recover to an OD at 600 nm (OD600) of 0.4 at which point an aliquot was taken as T0. Cells were then subject to a ‘recovery format’ for Rif treatment or a ‘MIC format’ for BCM or 5FU (Sigma) treatment. In the ‘recovery format’, cells were treated with 50 µg ml−1 Rif (Sigma) for 1 h, washed with LB, diluted tenfold and allowed to recover to the OD before dilution before being collected (T1 drug). In the ‘MIC format’ cells were diluted tenfold and treated with BCM (15 or 30 µg ml−1) or 5FU (1 or 5 µg ml−1) and allowed to recover to the OD before dilution before being collected (T1 drug). Untreated cells were grown in parallel to measure and control for mutant fitness (T1 fitness). Untreated cells were also passaged on agar plates by plating cells and scraping colonies after overnight incubation. All screening was done in triplicate. The screening format we used depended on the selected drug. Because Rif is a bacteriostatic drug37, we were not expecting sensitive mutants to decrease in abundance. Fortunately, previous work has shown that Rif produces a ‘post-antibiotic effect’ in which cells show a recovery delay after Rif is washed away and cells are allowed to resume growth55,56. For this reason, we designed a recovery format in which mutant rpoB pools were first treated with Rif, washed, diluted tenfold and then allowed to recover. Sensitive mutants would be expected to recover more slowly and would then be found at a lower abundance. As both BCM and 5FU are bactericidal37,54,57, we expected sensitive mutants to die and decrease in abundance. Therefore, two concentrations were selected for each drug: one concentration at the MIC at which only resistant mutants would survive and one at a lower concentration at which sensitive mutants would be lost. We isolated drug-specific effects by normalizing mutant abundances between drug treated (T1 drug) and untreated (T1 LB).

Screening library construction and sequencing

Genomic DNA was prepared from collected cells with the Monarch Genomic DNA purification kit (NEB). Libraries were prepared in two bins comprising rpoB 510–537 and 563–572. Here 100 ng DNA was first subject to two cycles of PCR in a 50 µl reaction containing Q5 polymerase (NEB) and 1 µM primers (Supplementary Table 2) designed to attach a unique barcode of 14 degenerate nucleotides to correct for PCR duplicates during analysis. Following barcode attachment, reactions were treated with 1 µl of exonuclease I (NEB) to remove unused barcodes for 1 h at 37 °C and then DNA was purified using a 1.5× ratio of PCRClean DX beads (Aline Biosciences). Sample barcode indexes and sequencing adaptor sequences were then attached with 18 cycles of exponential PCR before 2 rounds of purification with a 1× ratio of beads. Libraries were sequenced with the Novaseq 6000 SP300 cartridge (Illumina), aiming to collect 40 million reads per library and 2 × 106 unique barcodes for each experimental sample, allowing observation of 20–20,000 instances of each mutant.

Screening data analysis

Sequencing adaptors were trimmed using CutAdapt58. Next, sequences were filtered for correct length and primer sequences, and then grouped into ‘families’ by the aforementioned nucleotide barcodes. Families representing an original genomic molecule were checked for 80% consensus by nucleotide, defaulting to the wild-type sequence in the case of no consensus and then translated to the designed amino acid sequence. Families were grouped by mutant and the number of families corresponding to a single mutant was divided by the total number of families to yield mutant frequency. Only single-residue mutants were considered for analysis. To determine mutant fitness, mutant abundances after growth (T1 fitness) were normalized to abundances before growth (T0). To determine drug-specific effects, mutant abundances after drug treatment (T1 drug) were normalized to abundances after growth in LB (T1 fitness).

Strain construction

For all validation experiments, wild-type E. coli MG1655 was used as the parental strain (Supplementary Table 1). To generate selected rpoB mutants for reconstruction in MG1655, we used MAGE to introduce a kanamycin cassette at the 3′ end of rpoC in the E. coli EcNR2 strain. Selected rpoB mutants were generated in the resulting E. coli EcNR2 rpoc:kn. P1 phage-mediated transduction was used to move mutants to MG1655. For knockout strains, pKD46 was used as previously described59.

MIC and MBC assays

Overnight cultures of the indicated strains grown in LB were diluted 10,000-fold and growth in 0.2 ml of LB was monitored at 37 °C in a Bioscreen C machine (Growth Curves USA). MIC values were defined as the minimal antibiotic concentration for more than 90% growth inhibition after 15 h. For MIC and MBC assays adhering to clinical standards60, an initial inoculum of 5 × 105 cells was incubated with increasing concentrations of Rif in Mueller–Hinton broth at 37 °C for 18 h. The MIC was determined where at least 90% of bacterial growth is inhibited based on OD600. The MBC was determined as the lowest concentration of antibacterial agent that reduces the viability of the initial bacterial inoculum by at least 99.9% after 18 h at 37 °C.

Viability assays

Overnight cultures of the indicated strains grown in LB were diluted 1,000-fold and grown to an OD600 of 0.2 in 2 ml of medium before the addition of the indicated concentration of Rif (Sigma), ampicillin (Sigma), chloramphenicol (Sigma), tetracycline (Sigma), 2,2′-dipyridyl (Sigma) or thiourea (Sigma). After 1 h of treatment, cells were washed twice with an equal volume of LB. Serial dilutions of the washed cells were made and either plated on LB agar or placed in a Bioscreen C machine to monitor growth. For thymidine supplementation experiments, LB agar was supplemented with the indicated concentration of thymidine (Sigma) and 5FU (Sigma). For replication block experiments, strains were constructed in the PC2 background carrying a temperature-sensitive allele of the DNA replication protein dnaC39,42. Cells were grown as indicated to an OD600 of 0.2 at 30 °C before being shifted to 42 °C for 1.5 h. Cells were then added to media with 80 µg ml–1 Rif prewarmed to 42 °C for 30 min before being washed and plated on LB agar. Viability of cells was calculated by normalizing the number of treated to untreated colonies.

In vitro RNAP runoff assay

The rpoB mutant was cloned onto the PVS10 vector for recombinant expression and purification of E. coli core RNAP as previously described61. Than 3 pmol of RNAP core was mixed with equimolar σ70 and template DNA with sequence: tccagatcccgaaaatttatcaaaaagagtattgacttaaagtc taacctataggatacttacagccATCGAGAGGGCCACGGCGAACAGCCAACCCAATCGAACAGGCCTGCTGGTAATCGCAGGCCTTTTTATTTGGATCCCCGGGTA (capital letters denote transcribed sequence) in 20 µl TB50 buffer (20 mM Tris-HCl pH 8; 10 mM MgCl2, 50 mM NaCl, 0.03% Igepal-60) and incubated 5 min at 37 °C. Assembled transcription complexes were then treated with 2 µl of Rif (20 µg ml–1) and incubated for 5 min at 37 °C before being transferred to 10 µl of NeutrAvidin beads (Fisher) and shaken for 5 min at 25 °C. Samples were washed four times with 1 ml of TB50. Adenosine triphosphate (ATP), guanosine triphosphate (GTP), uridine triphosphate (UTP) and 5 µM cytidine  triphosphate (CTP) premixed with CTP-αP32 was added to 1 mM and incubated at 37 °C. Then 10 µl aliquots were taken after 3, 5, 10, 20, 30 or 40 min and mixed with SB (1× tris-borate-EDTA (TBE); 20 mM EDTA; 8 M urea; 0.025% xylene cyanol, 0.025% bromophenol blue), heated for 5 min at 100 °C and loaded on a 30% (20 × 20 cm2) (19:1) polyacrylamide gel with 7 M urea and TBE prerun for 6 min. The gel was run for 50 min at 50 W before being transferred to an X-ray film for overnight exposure. Gel intensity was quantified using GelQuant.NET.

ChIP–seq

Overnight cultures of rpoB wild-type rpoC-10X-His and rpoB T525D rpoC-10X-His were diluted 1,000-fold and grown to an OD600 of 0.2 in 25 ml of LB at 37 °C before the addition of 80 µg ml–1 Rif. After treatment for 1 h, cells were washed once in an equal volume of LB. Cells were allowed to recover for 1 h in LB at 37 °C before crosslinking with 1% formaldehyde at 37 °C for 20 min. A final concentration of 250 mM glycine was added to quench the reaction. Cells were collected by centrifugation at ×5,000g and washed twice with ice cold 1 phosphate buffered saline (PBS) before being resuspended in 1 ml of lysis buffer (10 mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.1% sodium deoxycholate, 0.5% N-lauroylsarcosine) plus 2 mg ml−1 lysozyme with protease inhibitor (Roche) and incubated at 37 °C for 30 min. DNA was sheared using an ultrasonicator Covaris M220 on a 10 s on/10 s off cycle for a total of 50 cycles. Supernatant was incubated with 5 µg ml–1 6X-His-tag antibody (Proteintech) and incubated at 4 °C overnight.

Then 50 µl per sample of Protein A/G beads were pre-equilibrated with 1 ml of ice cold 1× PBS +0.5% bovine serum albumin (BSA) and incubated with samples for 0.5 h at 4 °C. Samples were washed five times in 1 ml of RIPA buffer (50 mM HEPES pH 7.5, 250 mM LiCl, 1 mM EDTA, 1% NP40, 0.7% sodium deoxycholate) and given a final wash in 1× TE (100 mM Tris-Cl pH 8, 10 mM EDTA pH 8). Complexes were uncrosslinked in 250 µl of 1× TE + 4 µl of RNAseA for 1 h at 37 °C and then left overnight at 65 °C with 1% sodium dodecyl sulfate (SDS) and 1 mg ml−1 proteinase K. DNA was purified with ChIP Clean and Concentrate (Zymo). ChIP experiments were done in duplicate.

For sequencing, sample libraries were prepared using the NEBNext ChIP–seq library kit (NEB) according to the manufacturer’s instructions. Libraries were checked on TapeStation 2200 (Agilent) for quality control. Samples were sequenced on NextSeq 2000 (Illumina). Bowtie62 and Deeptools63 were used for alignment and analysis, respectively.

Analysis of DNA fragmentation

For DNA fragmentation experiments, cells were diluted 1,000-fold from overnight cultures and grown to an OD600 of 0.2 in 2 ml of medium before the addition of 80 µg ml–1 Rif or 125 ng ml−1 norfloxacin. After 1 h of treatment, cells were washed twice with an equal volume of LB before being fixed with 4% formaldehyde for terminal deoxynucleotide TUNEL. Labelling of DNA fragments was performed using the Apo-Direct Kit (BD Bioscience) following manufacturer’s instructions. Samples were collected with a FACSCalibur flow cytometer (BD Biosciences) and at least 50,000 cells were collected for each sample. The percentage of TUNEL positive cells for a given condition is the percentage of cells exceeding the signal detected in more than 99% of untreated cells.

SLR-qPCR

The number of DSBs in the genomic DNA was determined using SLR-qPCR38. SLR-qPCR can be used for detection of any lesion or strand break that creates a barrier to amplification by DNA polymerase64. To quantify DSBs in genomic DNA, indicated strains were inoculated in LB. Overnight cultures of indicated strains were diluted 1,000-fold in LB and allowed to grow to an OD600 of 0.2 at 37 °C. Cells were treated either with Rif (80 µg ml–1) or the carrier solvent dimethyl sulfoxide (DMSO) for 1 h at 37 °C. Cells were harvested by centrifugation and washed twice with PBS. Genomic DNA was isolated using a Monarch Genomic DNA isolation kit (NEB).

The reaction mixture contained 1× SYBR Green mix (Applied Biosystems), 500 nM of each primer and 1 ng of template DNA in a total volume of 20 µl per well. Two sets of primers (Supplementary Table 3), yielding a short and a long amplicon provide data representing the total amount of template (an internal normalization control) and undamaged DNA, respectively. The two primer pairs had comparable efficiency of amplification and yielded a single PCR product as judged by agarose gel analysis. Data analysis was done as described38 using a modified version of the 2−ΔΔCT method. DSB density was measured using genomic DNA from untreated cells as reference. DNA damage was calculated as DSBs per 10 kilobase DNA.

For replication block experiments, a dual plasmid system expressing dCas9 and a guide RNA targeting the oriC was introduced to cells of interest as previously reported41. Cells were grown to an OD600 of 0.2 at 37 °C as described above, and dCas9 was induced with 200 ng ml−1 Tc for 30 min before adding Rif.

Measurement of reactive oxygen species

Cells were diluted 1,000-fold from overnight cultures and grown to an OD600 of 0.2 in 2 ml of medium before the addition of 80 µg ml–1 Rif or 10 µg ml–1 ampicillin. Cells were incubated with antibiotic for 30 min before the addition of 10 mM carboxy-H2DCFDA (Thermo), after which cells were incubated for another 30 min. Cells were then washed with an equal volume of PBS, normalized for cell number and transferred to an opaque 96-well plate, after which fluorescent intensity was measured with a microplate reader. A blank well loaded with an equal volume of PBS was used to control for background fluorescence.

Western blot

Cells were diluted 1,000-fold from overnight cultures and grown to an OD600 of 0.2 in 2 ml of medium before the addition of 80 µg ml–1 Rif for 1 h. Cells were then collected, resuspended in lysis buffer (10 mM Tris-HCl pH 7.5, 4% SDS), mixed with 4× lithium dodecyl sulfate (LDS) sample buffer (Invitrogen), and boiled at 95 °C for 10 min before loading on a NuPAGE 4–12% Bis-Tris precast gel (Thermo) for electrophoresis at 200 V for 40 min. Gel was then semidry transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore) and incubated with the specified antibodies at 4 °C overnight in SuperBlock T20 blocking buffer (Thermo) before development the following day. Antibodies used were E. coli RNAP beta Monoclonal Antibody clone 8RB13 mouse mAB at 1:2,000 (663905; Biolegend) and LexA Antibody (E-7) at 1:200 (sc-365999; Santa Cruz). Gel intensity was quantified using GelQuant.NET.

RT–qPCR experiments

RNA was prepared from cells treated with 80 µg ml–1 Rif for 1 h using Trizol and Direct-zol RNA microprep (Zymo). RT–qPCR was done with 100 ng of RNA with the Luna RT–qPCR kit (NEB) and Quantstudio 7 (Applied Biosystems) using primers targeting rpsL as a control (Supplementary Table 5).

RNA-sequencing library preparation and analysis

RNA-sequencing libraries were prepared from mid log cells grown in LB with the NEB Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760S). Reads were trimmed with Cutadapt and then aligned to the E. coli genome with Bowtie2 (ref. 62). DESeq2 (ref. 65) was used to analyse differential expression.

Metabolomics

Mid log cells grown in LB were spun down, washed with PBS and resuspended in 1 m; of dry-ice-cooled extraction buffer (50% methanol, 1% formic acid, 10 µM labelled UTP; 13C9, 15N2) optimized for UTP extraction. Cells were transferred to Beadblaster (Benchmark Scientific) tubes and homogenized with ten cycles (30 s on, 30 s off). Homogenized samples were transferred to a 2 ml glass vial and vortexed with 0.4 ml of HPLC grade water and 0.8 ml of chloroform. Samples were then incubated at 4 °C for 30 min and the supernatant was separated and dried in a SpeedVac (Thermo Scientific) before being resuspended in 40 µl of HPLC grade water. The resuspended sample was then centrifuged to remove debris and transferred into a 250 µl glass insert for LC–MS analysis at the NYU metabolomics core.

Transcription kinetics

Transcription elongation rates were measured with a multiprobe (Supplementary Table 3) qPCR assay along the lac operon as previously described43. E. coli cells were grown to OD600 of 0.4 before induction by 1 mM isopropyl beta-d-thiogalactopyranoside (IPTG). Following induction, aliquots were withdrawn at 10 s intervals into a tube containing stop solution (60% EtOH, 2% phenol, 10 mM EDTA) precooled to −20 °C. RNA was extracted using Trizol (Invitrogen) and the Direct-zol RNA Microprep kit (Zymo) according to manufacturer’s instructions. Then 100 ng of total RNA was converted to complementary DNA using Superscript IV reverse transcriptase (ThermoFisher) and RNaseOut (ThermoFisher). Real-time qPCR amplification was performed with SYBR Green (Invitrogen) and Quantstudio 7 (Applied Biosystems). Data analysis was done as previously described43.

NETseq

NETseq libraries were prepared and analysed as previously described4, with modifications to the pause calling algorithm. Pauses were called using 100-nucleotide sliding windows with the condition that the pause is the maximum signal within the window and the signal is 2 s.d. above the window mean.

Evolutionary sequence analysis

The KEGG orthology database49 was mined for orthologues of E. coli rpoB and analysed in a similar manner to work previously done with rpoD28. In brief, orthologues were filtered for bacterial proteins that were of similar length to E. coli rpoB yielding 1,342 sequences. Next, sequences were aligned with Clustal Omega66 and positional conservation was calculated by Jensen–Shannon divergence50. Orthologue variants within the rpoB binding site were determined by comparison to E. coli MG1655 rpoB and their number and frequency were calculated.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

[ad_2]

Source link

Latest news

What Happens During a Fire Watch? Inside the Process and Protocols

When a fire alarm system fails or a sprinkler line goes offline, things don’t pause until it’s fixed. In...

Bremont Is Sending a Watch to the Moon’s Surface

A multifaceted decahedral black ceramic bezel and sandwich-style three-piece case—a reworking of Bremont's signature Trip-Tick construction—house a chronometer-rated...

The Most WIRED Watches at Watches and Wonders 2026

The case is white zirconium oxide ceramic with a Ceratanium bezel and back, rated to handle temperature swings...

Bitcoin Price Pumps 6% Near $75,000 As Shorts Liquidate

Bitcoin price surged more than 5% in the evening of April 13, climbing near the $75,000...

You Can Soon Buy a $4,370 Humanoid Robot on AliExpress

Listing consumer electronics on the internet's large ecommerce marketplaces is a key step in “democratizing” the products, allowing...

Must read

You might also likeRELATED
Recommended to you