Cells and viruses
Cell lines used in this study were obtained from ATCC (HEK293T and Vero E6), Thermo Fisher Scientific (ExpiCHO-S cells, FreeStyle 293-F cells and Expi293F cells), Takara (Lenti-X 293T cells), a gift from J. Bloom (HEK293T-ACE2)52, or generated in-house (Vero E6-TMPRSS2, BHK-21-GFP1–10 and Vero E6-TMPRSS2-GFP11)3,53. None of the cell lines used were authenticated or tested for mycoplasma contamination. SARS-CoV-2 isolates used in this study were obtained through BEI Resources, NIAID, NIH: (hCoV-19/USA-WA1/2020, NR-52281 deposited by the Centers for Disease Control and Prevention ; Lineage B.1.1.529, BA.2; Omicron Variant Isolate hCoV-19/USA/CO-CDPHE-2102544747/2021, NR-56520; Lineage XBB.1.5; Omicron Variant Isolate hCoV-19/USA/MD-HP40900/2022, NR-59104, contributed by A. S. Pekosz). Viruses were propagated and titrated on Vero E6-TMPRSS2 cells in house. The genomic sequences of all strains were confirmed by Sanger and/or next generation sequencing.
Human donors
Samples from cohorts v–viii along with those from patients undergoing dialysis (DP) kidney transplant recipients (KTR) and healthcare workers (HCW) were obtained from SARS-CoV-2 convalescent and vaccinated individuals under study protocols approved by the local institutional review boards (Canton Ticino and Canton Aargau Ethics Committees, Switzerland). PBMCs for effector function experiments were collected from healthy human donors under the informed consent and authorization of the Comitato Etico of Canton Ticino (Switzerland). All donors provided written informed consent for the use of blood and blood derivatives (such as peripheral blood mononuclear cells, sera or plasma) for research. Sera and PBMCs from cohorts i–iv were obtained from the HAARVI study approved by the University of Washington Human Subjects Division Institutional Review Board (STUDY00000959). Demographic data for these individuals is presented in Supplementary Tables 5 and 6.
Constructs
The full-length Wu/G614, Delta, BA.1, BA.2, and BA.4/5 S constructs with a 21-amino-acid C-terminal deletion used for pseudovirus assays were previously described elsewhere3,54. The full-length BA.2.75.2 and XBB.1 S constructs containing a 21-amino-acid C-terminal deletion were codon optimized, synthesized, and inserted the HDM vector by Genscript. The full-length BQ.1.1 S construct containing a 21-amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct and the full-length XBB.1.5 containing a 21-amino-acid C-terminal deletion was generated by mutagenesis of the XBB.1 S construct by Genscript.
S expression plasmids used for the generation of VSV pseudoviruses harbour the following mutations. BA.1: A67V, Δ69-70, T95I, G142D, Δ143–145, Δ211, L212I, ins214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F; BA.2: T19I, L24-, P25-, P26-, A27S, G142D, V213G, G339D, S371L, S373P, S375F, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K; K417N, N440K, G446S, N460K, S477N, T478K, E484A, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; BA.2.75.2: T19I, L24-, P25-, P26-, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K, D1199N; BQ.1: T19I, L24-, P25-, P26-, A27S, Δ69-70, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; BQ.1.1: T19I, L24-, P25-, P26-, A27S, Δ69-70, G142D, V213G, G339D, R436T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; BF.7: T19I, L24-, P25-, P26-, A27S, Δ69-70, G142D, V213G, G339D, R436T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; XBB.1: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486S, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; XBB.1.5: T19I, L24-, P25-, P26-, A27S, V83A, G142D, Y144-, H146Q, Q183E, V213E, G252V, G339H, R346T, L368I, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, V445P, G446S, N460K, S477N, T478K, E484A, F486P, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; CH.1.1: T19I, del24–26, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, G446S, L452R, N460K, S477N, T478K, E484A, F486S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K; BN.1: T19I, del24–26, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, R346T, K356T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, F490S, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K.
For BLI and cryo-EM, the SARS-CoV-2 Wu RBD construct containing an N-terminal mu-phosphatase secretion signal and a C-terminal octa-histidine tag followed by flexible linker and Avi tag was previously described elsewhere55. The BA.4/5 RBD construct containing an N-terminal BM40 secretion tag and a C-terminal octa-histidine tag followed by flexible linker and Avi tag was previously described elsewhere3. The BA.2.75.2, BQ.1.1, XBB.1, and XBB.1.5 RBD constructs containing an N-terminal BM40 secretion tag and a C-terminal octa-histidine tag followed by flexible linker and Avi tag were codon optimized, synthesized, and inserted into the pcDNA3.1(+) vector by Genscript. The boundaries of the construct are N-328RFPN331 and 528KKST531-C. The monomeric human ACE2 ectodomain (residues 19–615) construct used for BLI contains an N-terminal signal peptide and a 10x His tag and was synthesized and inserted into pTwist-CMV by Twist Bioscience.
For SPR, SARS-CoV-2 RBD plasmids encoding residues 328–531 of the S protein from GenBank NC_045512.2 with an N-terminal signal peptide and a C-terminal 8×His–Avi Tag or thrombin cleavage site–8×His–Avi tag. The ACE2 construct used for SPR and cryo-EM, encodes for residues 19–615 from Uniprot entry Q9BYF1 with a C-terminal thrombin cleavage site–TwinStrep–10×His–GGG tag, and N-terminal signal peptide.
Generation of VSV pseudoviruses
Replication-defective VSV pseudovirus expressing SARS-CoV-2 Wu and variant S were generated as previously described4 with some modifications to evaluate cohorts v–viii, DP, KTP and HCW, and monoclonal antibodies. Lenti-X 293T cells (Takara) were seeded in 15-cm2 dishes at a density of 10 × 106 cells per dish and the following day were transfected with 25 µg of S expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions. One day after transfection, cells were infected with VSV-luc (VSV-G) with a multiplicity of infection (MOI) of 3 for 1 h, rinsed three times with PBS containing Ca2+ and Mg2+, then incubated for an additional 24 h in complete medium at 37 °C. The cell supernatant was clarified by centrifugation, aliquoted, and frozen at −80 °C.
Pseudotyped VSV was produced as previously described3 to evaluate cohorts i–iv. In brief, HEK293T cells were split into poly-d-lysine-coated 15-cm plates and grown overnight until they reached approximately 70–80% confluency. The cells were washed 3 times with Opti-MEM (Gibco) and transfected with either the Wu-G614, Delta, BA.1, BA.2, BA.4/5, BA.2.75.2, BQ.1.1, XBB.1, or XBB.1.5 S constructs using Lipofectamine 2000 (Life Technologies). After 4–6 h, the medium was supplemented with an equal volume of DMEM supplemented with 20% FBS and 2% penicillin-streptomycin. The cells were incubated for 20–24 h, washed 3 times with DMEM, and infected with VSVΔG-luc. Two hours after VSVΔG-luc infection, the cells were washed an additional five times with DMEM. The cells were grown in DMEM supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant diluted 1:25, from CRL-2700, ATCC) for 18–24 h, after which the supernatant was harvested and clarified by low-speed centrifugation at 2,500g for 10 min. The supernatant was then filtered (0.45 μm) and some virus stocks were concentrated 10 times using a 30-kDa centrifugal concentrator (Amicon Ultra). The pseudotyped viruses were then aliquoted and frozen at −80 °C.
VSV pseudovirus neutralization
For cohorts v–viii, DP, KTP and HCW, and monoclonal antibodies, Vero E6 cells were grown in DMEM supplemented with 10% FBS and seeded into white-walled 96-well plates (PerkinElmer, 6005688) at a density of 20,000 cells per well. The next day, monoclonal antibodies were serially diluted in pre-warmed complete medium, mixed with pseudoviruses and incubated for 1 h at 37 °C in round bottom polypropylene plates. Medium from cells was aspirated and 50 µl of pseudovirus–monoclonal antibody complexes were added to cells, which were then incubated for 1 h at 37 °C. An additional 100 µl of pre-warmed complete medium was then added on top of complexes and cells were incubated for an additional 16–24 h. Conditions were tested in duplicate or triplicate wells on each plate and 6–8 wells per plate contained untreated infected cells (defining the 0% of neutralization (MAX RLU) value) and uninfected cells (defining the 100% of neutralization (MIN RLU) value). Virus–monoclonal antibody-containing medium was then aspirated from cells and 50 or 100 µl of a 1:2 dilution of SteadyLite Plus (PerkinElmer) or Bio-Glo (Promega) in PBS with Ca2+ and Mg2+ was added to cells. Plates were incubated for 15 min at room temperature and then analysed on the Synergy-H1 (BioTek). The average relative light units (RLU) of untreated infected wells (MAX RLUave) were subtracted by the average of MIN RLU (MIN RLUave) and used to normalize percentage of neutralization of individual RLU values of experimental data according to the following formula: (1 − (RLUx – MIN RLUave)/(MAX RLUave – MIN RLUave)) × 100. Data were analysed with Microsoft Excel (v16) and Prism (v.9.1.0). IC50 values were calculated from the interpolated value from the log(inhibitor) versus response, using variable slope (four parameters) non-linear regression with an upper constraint of <100. Each neutralization experiment was conducted on at least two independent experiments—that is, biological replicates—in which each biological replicate contains a technical duplicate or triplicate.
For cohorts i–iv, Vero E6-TMPRSS2 were split into white-walled, clear-bottom 96-well plates (Corning) and grown overnight until they reached approximately 70% confluency. Plasma was diluted in DMEM starting at a 1:10 dilution and serially diluted in DMEM at a 1:3 dilution thereafter. Pseudotyped VSV was diluted at a 1:25 to 1:100 ratio in DMEM and an equal volume was added to the diluted plasma. The virus–plasma mixture was incubated for 30 min at room temperature and added to the Vero E6-TMPRSS2 cells. After two hours, an equal volume of DMEM supplemented with 20% FBS and 2% penicillin-streptomycin was added to the cells. After 20–24 h, ONE-Glo EX (Promega) was added to each well and the cells were incubated for 5 min at 37 °C. Luminescence values were measured using a BioTek Synergy Neo2 plate reader. Luminescence readings from the neutralization assays were normalized and analysed using GraphPad Prism 9.1.0. The RLU values recorded from uninfected cells were used to define 100% neutralization and RLU values recorded from cells infected with pseudovirus without plasma were used to define 0% neutralization. ID50 were determined from the normalized data points using a [inhibitor] versus normalized response–variable slope model using at least two technical repeats to generate the curve fits. At least two biological replicates with two distinct batches of pseudovirus were conducted for each sample.
Neutralization of authentic SARS-CoV-2 viruses
Vero E6-TMPRSS2 cells were seeded into black-walled, clear-bottom 96-well plates at 20,000 cells per well and cultured overnight at 37 °C. The next day, 9-point fourfold serial dilutions of monoclonal antibodies were prepared in growth medium (DMEM + 10% FBS). The different SARS-CoV-2 strains were diluted in infection medium (DMEM + 2% BSA) at a final MOI of 0.01 plaque-forming units per cell, added to the monoclonal antibody dilutions and incubated for 30 min at 37 °C. Medium was removed from the cells, monoclonal antibody–virus complexes were added and incubated at 37 °C for 18 h (WA-1 and XBB.1.5) or 24 h (BA.2). Cells were fixed with 4% PFA (Electron Microscopy Sciences, 15714S), permeabilized with Triton X-100 (SIGMA, X100-500ML) and stained with an antibody against the viral nucleocapsid protein (Sino Biologicals, 40143-R001) followed by a staining with the nuclear dye Hoechst 33342 (Fisher Scientific, H1399) and a goat anti-rabbit Alexa Fluor 647 antibody (Invitrogen, A-21245). Plates were imaged on a Cytation5 plate reader. Whole well images were acquired (12 images at 4× magnification per well) and nucleocapsid-positive cells were counted using the manufacturer’s software.
Pseudotyped VSV entry assays with protease inhibitors
Vero E6-TMPRSS2 or HEK293T-ACE2 were split into white-walled, clear-bottom 96-well plates (Corning) at a density of 18,000 or 36,000 cells, respectively, and grown overnight. The following day, the growth medium was removed and, for assays conducted with Vero E6-TMPRSS2, the cells washed once with DMEM. The cells were incubated for 2 h with DMEM containing 50 µM of Camostat (Sigma), Nafamostat (Sigma), E64d (Sigma), or 0.5% DMSO. All three protease inhibitors were dissolved in DMSO to a concentration of 10 mM and diluted in DMEM. The protease inhibitors were removed and pseudovirus diluted 1:50 or 1:200 in DMEM was added to the cells. After 2 h, an equal volume of DMEM supplemented with 20% FBS and 2% penicillin-streptomycin was added to the cells. After 20–24 h, ONE-Glo EX (Promega) was added to each well and the cells were incubated for 5 min at 37 °C. Luminescence values were measured using a BioTek Synergy Neo2 plate reader. Luminescence readings from the neutralization assays were normalized and analysed using GraphPad Prism 9.1.0. The RLU values recorded from uninfected cells were used to define 0% infectivity and RLU values recorded from cells incubated with 0.5% DMSO only and infected with pseudovirus were used to define 100% infectivity. Twelve technical replicates were performed for each inhibitor and pseudovirus and at least two biological replicates with two distinct batches of pseudovirus were conducted.
Recombinant protein production for BLI, FACS and cryo-EM
SARS-CoV-2 RBDs and human ACE2 were produced and purified from Expi293F cells as previously described3. In brief, cells were grown to a density of 3 × 106 cells per ml and transfected using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Three to five days post-transfection, proteins were purified from clarified supernatants using HisTrap HP affinity columns (Cytiva) and washed with ten column volumes of 20 mM imidazole, 25 mM sodium phosphate pH 8.0, and 300 mM NaCl before elution on a gradient to 500 mM imidazole, 25 mM sodium phosphate pH 8.0, and 300 mM NaCl. Proteins were buffer exchanged into 20 mM sodium phosphate pH 8 and 100 mM NaCl and concentrated using centrifugal filters (Amicon Ultra) before being flash frozen.
For cryo-EM, recombinant was expressed in ExpiCHO-S cells at 37 °C and 8% CO2 with kifunensine added to 10 µM. Cell culture supernatant was collected eight days post-transfection, supplemented with buffer to a final concentration of 80 mM Tris-HCl pH 8.0, 100 mM NaCl, and then incubated with BioLock (IBA) solution. ACE2 was purified using a 5-ml StrepTrap HP column (Cytiva) followed by isolation of the monomeric ACE2 by size-exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva) pre-equilibrated in PBS.
Recombinant S309 Fab used for cryo-EM was expressed by ATUM Bio using HEK293-derived suspension cells (lacking the N55Q mutation introduced for improving its manufacturability), purified using CaptureSelect IgG-CH1 resin and buffer exchanged into PBS (ATUM Bio).
Recombinant protein production for SPR binding assays and antigen-specific MBC repertoire analysis by ELISA
Proteins were expressed in Expi293F cells (Thermo Fisher Scientific) at 37 °C and 8% CO2. Transfections were performed using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell culture supernatants were collected 4–5 days after transfection and supplemented with 10× PBS to a final concentration of 2.5× PBS (342.5 mM NaCl, 6.75 mM KCl and 29.75 mM phosphates). SARS-CoV-2 RBDs were purified by IMAC using Cobalt or Nickel resin followed by buffer exchange into PBS using Amicon centrifugal filters (Milipore Sigma) or by size-exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva). For SPR binding measurements, recombinant ACE2 (residues 19–615 from Uniprot entry Q9BYF1 with a C-terminal thrombin cleavage site–TwinStrep–10×His–GGG tag and N-terminal signal peptide) was expressed in Expi293F cells at 37 °C and 8% CO2. Transfection was performed using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell culture supernatant was collected 7–8 days after transfection, supplemented to a final concentration of 80 mM Tris-HCl pH 8.0, 100 mM NaCl, and then incubated with BioLock solution (IBA GmbH). ACE2 was purified using a 1-ml StrepTrap HP column (Cytiva) followed by isolation of the monomeric ACE2 by size-exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva) pre-equilibrated in PBS. Recombinant S309 Fab used for SPR binding studies was produced in either ExpiCHO-S cells and purified using a Capture Select CH1-XL MiniChrom Column (Thermo Fisher), followed by buffer exchange into PBS using a HiPrep 26/10 Desalting Column (Cytiva) or in HEK293 suspension cells, purified using CaptureSelect IgG-CH1 resin and buffer exchanged into PBS (ATUM Bio).
Biolayer interferometry
BLI was used to assess binding of SARS-CoV-2 RBDs to human ACE2 using an Octet Red96 (Sartorius) and the Octet Data acquisition v11.1. Biotinylated Wu, BA.4/5, BA.2.75.2, BQ.1.1, XBB.1, and XBB.1.5 RBDs were diluted to a concentration of 5 ng µl−1 in 10X Octet kinetics buffer (Sartorius) and loaded onto pre-hydrated Streptavidin biosensors to a 1 nm total shift. The loaded tips were dipped into a 1:3 dilution series of monomeric human ACE2 starting at 900 nM or 300 nM for 300 s followed by dissociation in 10× kinetic buffer for 300 s. All steps of the affinity measurements using BLI were carried out at 30 °C with a shaking speed of 1,000 rpm. The resulting data were baseline subtracted and affinity measurements were calculated using a 1:1 global fit binding model with Octet Data Analysis HT software v12.0. Binding curves were plotted using GraphPad Prism 9.1.0.
In vivo studies
Mouse studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01). Virus inoculations were performed under anaesthesia that was induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering. Heterozygous K18-hACE2 C57BL/6 J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory. All animals were housed in groups of 3 to 5 and fed standard chow diets. The photoperiod was 12 h on/12 h off dark/light cycle. The ambient animal room temperature was 21 °C, controlled within ±1 °C and the room humidity was 50%, controlled within ±5%. Eight- to ten-week-old female K18-hACE2 mice were administered indicated doses of S309 or isotype control (anti-WNV hE1651) antibody by intraperitoneal injection one day before intranasal inoculation with 104 FFU of BQ.1.1. Weight was recorded daily, and animals were euthanized on day 6 after virus inoculation.
All hamster experiments were performed according to the French legislation and in compliance with the European Community Council Directives (2010/63/UE, French Law 2013–118, 6 February 2013) and according to the regulations of Pasteur Institute Animal Care Committees. The Animal Experimentation Ethics Committee (CETEA 89) of the Institut Pasteur approved this study (200023) before experiments were initiated. Hamsters were housed by groups of 4 animals and manipulated in class III biosafety cabinets in the Pasteur Institute animal facilities accredited by the French Ministry of Agriculture for performing experiments on live rodents. All animals were handled in strict accordance with good animal practice. Male golden Syrian hamsters (Mesocricetus auratus; RjHan:AURA) of 5–6 weeks of age (average weight 60–80 grams) were purchased from Janvier Laboratories and handled under specific pathogen-free conditions. The animals were housed and manipulated in isolators in a Biosafety level-3 facility, with ad libitum access to water and food. Before manipulation, animals underwent an acclimation period of one week. Twenty-four hours before infection, the hamsters received an intraperitoneal injection of different concentrations of the monoclonal antibodies S309 (0.6, 1.7, 5 and 15 mg kg−1, hamster IgG2a), or the control isotype MPE8 (15 mg kg−1, hamster IgG2a). Animal infection was performed as previously described56. In brief, the animals were anaesthetized with an intraperitoneal injection of 200 mg kg−1 ketamine (Imalgène 1000, Merial) and 10 mg kg−1 xylazine (Rompun, Bayer), and 100 µl of physiological solution containing 6 × 104 plaque-forming units of SARS-CoV-2/Omicron_XBB.1.5 (GISAID ID: EPI_ISL_16353849, kindly provided by O. Schwartz and colleagues) was then administered intranasally to each animal (50 µl per nostril). Mock-infected animals received the physiological solution only. Infected and mock-infected hamsters were housed in separated isolators and were followed-up daily, for four days, when the body weight and the clinical score were noted. At day 4 post-inoculation, the animals were euthanized with an excess of anaesthetics (ketamine and xylazine) and exsanguination. Blood samples were collected by cardiac puncture; after coagulation, the tubes were centrifuged at 2,000g during 10 min at 4 °C, the serum was collected and frozen at −80 °C until further analyses. The lungs were collected, weighted and frozen at −80 °C until further analyses.
Measurement of viral RNA levels
Mouse tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1 ml of DMEM medium supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at approximately 10,000g for 5 min and stored at −80 °C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Fisher Scientific) on the Kingfisher Flex extraction robot (Thermo Fisher Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific). Reverse transcription was carried out at 48 °C for 15 min followed by 2 min at 95 °C. Amplification was accomplished over 50 cycles as follows: 95 °C for 15 s and 60 °C for 1 min. Copies of total (genomic and subgenomic) SARS-CoV-2 N gene RNA in samples were determined using a previously published assay57. In brief, a TaqMan assay was designed to target a highly conserved region of the N gene (forward primer: ATGCTGCAATCGTGCTACAA; reverse primer: GACTGCCGCCTCTGCTC; probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.
For hamster studies, frozen lung fragments were weighted and homogenized with 1 ml of ice-cold DMEM (31966021, Gibco) supplemented with 1% penicillin/streptomycin (15140148, Thermo Fisher) in Lysing Matrix M 2 ml tubes (116923050-CF, MP Biomedicals) using the FastPrep-24 system (MP Biomedicals), and the following scheme: homogenization at 4.0 m s−1 for 20 s, incubation at 4 °C for 2 min, and new homogenization at 4.0 m s−1 for 20 s. The tubes were centrifuged at 10,000g for 1 min at 4 °C. Afterwards, 125 µl of the tissue homogenate supernatant were mixed with 375 μl of Trizol LS (10296028, Invitrogen) and the total RNA was extracted using the Direct-zol RNA MiniPrep Kit (R2052, Zymo Research). The presence of SARS-CoV-2 RNA in these samples was evaluated by one-step quantitative PCR with reverse transcription in a final volume of 12.5 μl per reaction in 384-wells PCR plates using a thermocycler (QuantStudio 6 Flex, Applied Biosystems). In brief, 2.5 μl of RNA were added to 10 μl of a master mix containing 6.25 μl of 2× reaction mix, 0.2 μl of MgSO4 (50 mM), 0.5 μl of Superscript III RT/Platinum Taq Mix (2 UI µl−1) and 3.05 μl of nuclease-free water containing the nCoV_IP2 primers (nCoV_IP2-12669Fw: 5′-ATGAGCTTAGTCCTGTTG-3′; nCoV_IP2-12759Rv: 5′-CTCCCTTTGTTGTGTTGT-3′) at a final concentration of 400 nM, and the nCoV_IP2 probe (5′-FAM-AGATGTCTTGTGCTGCCGGTA-3′-TAMRA) at a final concentration of 200 nM. The amplification conditions were as follows: 55 °C for 20 min, 95 °C for 3 min, 50 cycles of 95 °C for 15 s and 58 °C for 30 s, and a last step of 40 °C for 30 s. Viral load quantification (expressed as RNA copy number per mg of tissue) was assessed by linear regression using a standard curve of six known quantities of RNA transcripts containing the RdRp sequence (ranging from 107 to 102 copies).
Viral plaque assay
Vero E6-TMPRSS2-ACE2 cells were seeded at a density of 1 × 105 cells per well in 24-well tissue culture plates. The following day, medium was removed and replaced with 200 μl of material to be titrated diluted serially in DMEM supplemented with 2% FBS. One hour later, 1 ml of methylcellulose overlay was added. Plates were incubated for 72 h, and then fixed with 4% paraformaldehyde (final concentration) in PBS for 20 min. Plates were stained with 0.05% (w/v) crystal violet in 20% methanol and washed twice with distilled, deionized water.
End-point virus titration in hamsters
Lung tissues were homogenized as described above for measurement of viral RNA. To quantify infectious SARS-CoV-2 particles, lung homogenates titrations were performed on confluent Vero E6 cells in 96- well plates. Viral titres were expressed as 50% tissue culture infectious dose (TCID50) per mg tissue58.
Transient expression of recombinant SARS-CoV-2 S and flow cytometry
ExpiCHO-S cells were seeded at 6 × 106 cells per ml in a volume of 5 ml in a 50-ml bioreactor. The following day, cells were transfected with SARS-CoV-2 S glycoprotein-encoding pcDNA3.1(+) plasmids (BetaCoV/Wuhan-Hu-1/2019, accession number MN908947, Wu-D614; Omicron BA.2, BQ.1.1, XBB.1, XBB.1.5, BN.1 or BA.2-E340A generated by overlap PCR mutagenesis of the Wu-D614 plasmid) harbouring the Δ19 C-terminal truncation. S-encoding plasmids were diluted in cold OptiPRO SFM (Life Technologies, 12309-050), mixed with ExpiFectamine CHO Reagent (Life Technologies, A29130) and added to cells. Transfected cells were then incubated at 37 °C with 8% CO2 with an orbital shaking speed of 250 rpm (orbital diameter of 25 mm) for 24 to 48 h. Transiently transfected ExpiCHO-S cells were harvested and washed twice in wash buffer (PBS 2% FBS, 2mM EDTA). Cells were counted and distributed into round bottom 96-well plates (Corning, 3799) and incubated with serial dilutions of mAb starting at 10 μg ml−1. Alexa Fluor 647-labelled Goat anti-human IgG secondary antibody (Jackson ImmunoResearch, 109-606-098) was prepared at 2 μg ml−1 and added onto cells after two washing steps. Cells were then washed twice and resuspended in wash buffer for data acquisition at Ze5 cytometer (Bio-Rad).
Measurement of effector functions triggered by monoclonal antibodies
ADCC assays were performed using ExpiCHO-S cells transiently transfected with SARS-CoV-2 S glycoproteins (Wu-D614, BA.2, BQ.1.1, XBB.1, XBB.1.5, BN.1 or BA.2-E340A) as target cells. Natural killer cells were isolated from fresh blood of healthy donors using the MACSxpress WB NK cell isolation kit, human (Miltenyi Biotec, 130-127-695). Target cells were incubated with titrated concentrations of monoclonal antibody for 10 min and then with primary human natural killer cells at an effector to target ratio ranging from 6:1 to 9:1. ADCC was measured using the LDH release assay (Cytotoxicity Detection Kit (LDH) (Roche, 11644793001)) after 4 h incubation at 37 °C.
ADCP assays were performed using ExpiCHO-S cells transiently transfected with SARS-CoV-2 S glycoproteins and labelled with PKH67 (Sigma-Aldrich) as target cells. PMBCs from healthy donors were labelled with CellTrace Violet (Invitrogen) and used as source of phagocytic effector cells. Target cells (10,000 per well) were incubated with titrated concentrations of monoclonal antibody for 10 min and then mixed with PBMCs (200,000 per well). The next day, cells were stained with APC-labelled anti-CD14 antibody (BD Pharmingen), BV605-labelled anti-CD16 antibody (Biolegend), BV711-labelled anti-CD19 antibody (Biolegend), PerCP/Cy5.5-labelled anti-CD3 antibody (Biolegend), APC/Cy7-labelled anti-CD56 antibody (Biolegend) for the identification of CD14+ monocytes. After 20 min, cells were washed and fixed with 4% paraformaldehyde before acquisition on a ZE5 Cell Analyzer (Bio-Rad). Data were analysed using FlowJo software (v10.8.1). The percentage ADCP was calculated as the percentage of monocytes (CD3−CD19–CD14+ cells) positive for PKH67.
Measurement of effector functions triggered by plasma antibodies
Antibody-dependent activation of human FcγRIIIa by plasma antibodies was quantified using a bioluminescent reporter assay. ExpiCHO-S cells transiently expressing full-length SARS-CoV-2 S from Wu-D614, BA.5, BQ.1.1 or XBB.1 (target cells) were incubated with serial dilutions of plasma from immune donors. After a 20-min incubation, Jurkat reporter cells stably expressing FcγRIIIa V158 and a NFAT-driven luciferase reporter gene (effector cells) were added at an effector to target ratio of 6:1. Signalling was quantified by the luciferase signal produced via activation of the NFAT pathway. Luminescence was measured after 22 h of incubation at 37 °C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
Natural killer cell-mediated ADCC induced by plasma antibodies was measured as described for ADCC except that ExpiCHO-S cells transiently expressing full-length SARS-CoV-2 S from Wu-D614, BA.1, BA.5, BA.2.75.2, BQ.1.1 or XBB.1 (target cells) were incubated with plasma from immune donors at a single dilution (1:200).
Antigen-specific MBC repertoire analysis of secreted IgGs
Replicate cultures of total unfractionated PBMCs obtained from SARS-CoV-2 infected and/or vaccinated individuals were seeded in 96 U-bottom plates (Corning) in RPMI1640 supplemented with 10% fetal calf serum (Hyclone), sodium pyruvate, MEM non-essential amino acids, stable glutamine, 2-mercaptoethanol, penicillin-streptomycin, kanamycin and transferrin. MBC stimulation and differentiation was induced by adding 2.5 μg ml−1 R848 (3 M) and 1,000 U ml−1 human recombinant IL-2 at 37 °C and 5% CO2, as previously described59. After 10 days, the cell culture supernatants were collected for ELISA analysis.
Enzyme-linked immunosorbent assay
Ninety-six half-area well plates (Corning, 3690) were coated overnight at 4 °C with 25 μl of sarbecovirus RBDs prepared at 5 μg ml−1 in PBS pH 7.2. Plates were then blocked with PBS 1% BSA (Sigma-Aldrich, A3059) and subsequently incubated with serial dilutions of monoclonal antibodies for 1 h at room temperature. After 4 washing steps with PBS 0.05% Tween-20 (PBS-T) (Sigma-Aldrich, 93773), goat anti-human IgG-AP secondary antibody (Southern Biotech, 2040-04, diluted 1/500) was added and incubated for 1 h at room temperature. Plates were then washed four times with PBS-T and 4-nitrophenyl phosphate (pNPP, Sigma-Aldrich, 71768) substrate was added. After 30 min incubation, absorbance at 405 nm was measured using a plate reader (BioTek) and data were plotted using Prism GraphPad 9.1.0. To test plasma and MBC-derived antibodies, Spectraplate-384 with high protein binding treatment (custom made from PerkinElmer) were coated overnight at 4 °C with 3 µg ml−1 of different SARS-CoV-2 RBDs (produced in house) and S trimers (Acrobiosystems AG, SPN-C52H3, SPN-C522a, SPN-C522e, SPN-C522r, SPN-C522s, SPN-C522t and SPN-C524i) in PBS pH 7.2 or PBS alone as control. Plates were subsequently blocked with Blocker Casein (1%) in PBS (Thermo Fisher Scientific, 37528) supplemented with 0.05% Tween-20 (Sigma-Aldrich, 93773-1KG). The coated plates were incubated with diluted B cell supernatant for 1 h at room temperature. Plates were washed with PBS containing 0.05% Tween-20 (PBS-T), and binding was revealed using secondary goat anti-human IgG-AP (Southern Biotech, 2040-04). After washing, pNPP substrate (Sigma-Aldrich, 71768-25G) was added and plates were read at 405 nm after 1 h or 30 min.
Blockade of RBD binding to human ACE2
MBC culture supernatants were diluted in PBS and mixed with SARS-CoV-2 Wu RBD mouse Fc-tagged antigen (Sino Biological, 40592-V05H) or with biotinylated BQ.1.1 or XBB.1 RBDs (Acrobiosystems) at a final concentration of 20 ng ml−1 and incubated for 30 min at 37 °C. The mix was added for 30 min to ELISA 384-well plates (NUNC, P6366-1CS) pre-coated overnight at 4 °C with 4 µg ml−1 human ACE2 (produced in house) in PBS. Plates were washed with PBS containing 0.05% Tween-20 (PBS-T), and RBD binding was revealed using secondary goat anti-mouse IgG-AP (Southern Biotech, 1032-04) or Streptavidin-AP (Jackson ImmunoResearch). After washing, pNPP substrate (Sigma-Aldrich, 71768-25G) was added and plates were read at 405 nm after 1 h.
Blockade of binding to S
Human anti-S monoclonal antibodies (S2V29 for RBD site Ia, SA55 for RBD site IIa, S309 for RBD site IV23, S3H3 for domain C/SD160 and S2P6 for the stem helix61) were biotinylated using the EZ-Link NHS-PEO solid phase biotinylation kit (Pierce). Labelled monoclonal antibodies were tested for binding to Wu-G614, BQ.1.1 and XBB.1 S by ELISA and the optimal concentration of each monoclonal antibody to achieve 80% maximal binding was determined. Plasma samples were serially diluted and added to ELISA 96-well plates (Corning) pre-coated overnight at 4 °C with 1 µg ml−1 of S (Acrobiosystems) in PBS. After 30 min, biotinylated anti-S monoclonal antibodies were added at the concentration achieving 80% maximal binding and the mixture was incubated at room temperature for 30 min. Plates were washed and antibody binding was revealed using alkaline phosphatase-comjugated streptavidin (Jackson ImmunoResearch). After washing, pNPP substrate (Sigma-Aldrich) was added and plates were read at 405 nm. The percentage of inhibition was calculated as follow: (1 − (absorbance of sample − absorbance of negative control)/(absorbance of positive control − absorbance of negative control)) × 100.
PNGase F reaction to remove N-linked glycans on BN.1 RBD
Twenty micrograms of purified BN.1 RBD was combined with 2 µl PNGase F (500 units per µl, New England BioLabs, P0704S) and 5 µl of 10× GlycoBuffer 3and H2O (if necessary) to bring the total reaction volume to 50 μl. The reaction was incubated at room temperature overnight and used for SPR and mass intact mass spectrometry.
Intact mass spectrometry analysis and liquid chromatography–mass spectrometry analysis
Four micrograms of PNGase F-treated BN.1 RBD was used for each injection on the liquid chromatography–mass spectrometry (LC–MS) system to acquire intact mass spectrometry signal after separation of protease and protein by liquid chromatography (Agilent PLRP-S reversed phase column). Thermo MS (Q Exactive Plus Orbitrap) was used to acquire intact protein mass under denaturing conditions. BioPharma Finder 3.2 software was used to deconvolute the raw m/z data to protein average mass.
Peptide mapping with LC–MS was used to profile the site-specific glycosylation sites on BN.1 RBD. Glycopeptides containing only one specific glycan were achieved by selectively digesting with chymotrypsin protease. Twenty micrograms of each digest product (peptide with a single glycan) was analysed by LC–MS (Agilent AdvanceBio peptide mapping column and Thermo Q Exactive Plus Orbitrap MS). Peptide mapping data were analysed on Biopharma Finder 3.2 data analysis software.
SPR assays to measure binding of ACE2 and S309 Fab to RBDs
Measurements were performed using a Biacore T200 instrument or a Biacore 8k instrument using the Biacore Evaluation software (v.3.2.1). CM5 chips with covalently immobilized anti-Avi polyclonal antibody diluted to a final concentration of 25 µg ml−1 (GenScript, A00674-40) were used for surface capture of His–Avi tag containing RBDs. Running buffer was HBS-EP+ pH 7.4 (Cytiva) and measurements were performed at 25 °C. Experiments were performed with a fourfold dilution series of monomeric S309 Fab or ACE2 at 300, 75, 18.8 and 4.7 nM and were run as single-cycle kinetics. Data were double reference-subtracted and fit to a binding model using Biacore Insight software (v4.0.8.20368). The 1:1 binding model was used to determine the kinetic parameters. 2–14 replicates were performed for each ligand (RBDs) and analyte (ACE2 or S309 Fab) pair. For BN.1 RBD–S309 Fab binding, due to a low binding signal because of a slow association rate constant, a constant Rmax calculated from a control analyte was applied to calculate the kinetic parameters. Kd values are reported as the average of all replicates with the corresponding standard deviation (Supplementary Table 2 for ACE2 binding data and Supplementary Table 4 for S309 Fab binding data)
Cell–cell fusion assay
Cell–cell fusion assays using a split-GFP system was conducted as previously described3. In brief, Vero E6-TMPRSS2-GFP11 cells were split into 96-well, glass bottom, black-walled plates (CellVis) at a density of 36,000 cells per well. BHK-21-GFP1–10 cells were split into 6-well plates at a density of 1 × 106 cells per well. The following day, the growth medium was removed and replaced with DMEM containing 10% FBS and 1% penicillin-streptomycin and the cells were transfected with 4 µg of S protein using Lipofectamine 2000. Twenty-four hours after transfection, BHK-21-GFP1–10 cells expressing the S protein were washed three times using FluoroBrite DMEM (Thermo Fisher) and detached using an enzyme-free cell dissociation buffer (Gibco). The Vero E6-TMPRSS2-GFP11 were washed 3 times with FluoroBrite DMEM and 9,000 BHK-21-GFP1–10 cells were plated on top of the Vero E6-TMPRSS2-GFP11 cells. The cells were incubated at 37 °C and 5% CO2 in a Cytation 7 plate Imager (BioTek) and both bright-field and GFP images were collected every 30 min for 18 h. Fusogenicity was assessed by measuring the area showing GFP fluorescence for each image using Gen5 Image Prime v3.11 software.
To measure surface expression of the variant SARS-CoV-2 S protein, 1 × 106 transiently transfected BHK-21-GFP1–10 cells were collected by centrifugation at 1,000g for 5 min. The cells were washed once with PBS and fixed with 2% paraformaldehyde. The cells were washed twice with flow staining buffer (1% BSA, 1 mM EDTA, 0.1% NaN3 in PBS) and labelled with 25 µg ml−1 S2L20, an NTD-directed antibody that recognizes all currently and previously circulating SARS-CoV-2 variants, for 45 min. The cells were washed three times with flow staining buffer and labelled with a PE-conjugated anti-human IgG Fc antibody (Thermo Fisher) for 30 min. The cells were washed an additional three times and resuspended in flow staining buffer. The labelled cells were analysed using a BD FACSymphony A3. Cells were gated on singleton events and a total of 10,000 singleton events were collected for each sample. The fraction of S-positive cells was determined in FlowJo 10.8.1 by gating singleton events for the mock transfected cells on PE intensity.
Flow cytometry analysis of SARS-CoV-2 RBD-reactive MBCs
RBD–streptavidin tetramers conjugated to fluorophores were generated by incubating biotinylated Wu, BA.1, BA.2, BA.4/5 or BQ.1.1 with streptavidin at a 4:1 molar ratio for 30 min at 4 °C. Excess free biotin was then added to the reaction to bind any unconjugated sites in the streptavidin tetramers. The RBD-streptavidin tetramers were washed once with PBS and concentrated with a 30-kDa centrifugal concentrator (Amicon). An additional streptavidin tetramer conjugated to biotin only was generated and included in the staining.
Approximately 5 to 15 million PMBCs were collected 5–72 days post-vaccination for individuals who received either the Wu monovalent mRNA booster or Wu/BA.5 bivalent mRNA booster. The cells were collected by centrifugation at 1,000g for 5 mins at 4 °C and washed twice with PBS. The cells were then stained with Zombie Aqua dye (Biolegend; diluted 1:100 in PBS) for 30 min at room temperature after which the cells were washed twice with FACS staining buffer (0.1% BSA, 0.1% NaN3 in PBS). The cells were then stained with antibodies for CD20-PECy7 (BD), CD3-Alexa eFluor780 (Thermo Fisher), CD8-Alexa eFluor780 (Thermo Fisher), CD14-Alexa eFluor780 (Thermo Fisher), CD16-Alexa eFluor780 (Thermo Fisher), IgM-Alexa Fluor 647 (BioLegend), IgD-Alexa Fluor 647 (BioLegend), and CD38-Brilliant Violet 785 (BioLegend), all diluted 1:200 in Brilliant Stain Buffer (BD), along with the RBD-streptavidin tetramers for 30 min at 4 °C. The cells were washed three times, resuspended in FACS staining buffer, and passed through a 35-µm filter. The cells were examined using a BD FACSAria III and FACSDiva for acquisition and FlowJo 10.8.1 for analysis. Single live CD20+CD3−CD8−CD14−CD16−IgMloIgDloCD38loRBD+ cells were sorted based on reactivity to the Omicron and Wu RBDs into RNAlater and stored at −80 °C.
Cryo-EM sample preparation, data collection and data processing
Cryo-EM grids of BQ.1.1 RBD–ACE2–S309, XBB.1 RBD–ACE2–S309 or BN.1 RBD–ACE2–S309 complex were prepared fresh after purification by size-exclusion chromatography. For BQ.1.1 RBD–ACE2–S309 complex, 3 μl of 0.25 mg ml−1 BQ.1.1 RBD–ACE2–S309 were loaded onto freshly glow-discharged R 2/2 UltrAuFoil grids62, prior to plunge freezing using a vitrobot Mark IV (Thermo Fisher Scientific) with a blot force of 0 and 6 s blot time at 100% humidity and 22 °C. Data were acquired using an FEI Titan Krios transmission electron microscope operated at 300 kV and equipped with a Gatan K3 direct detector and Gatan Quantum GIF energy filter, operated in zero-loss mode with a slit width of 20 eV. For BQ.1.1 RBD–ACE2-S309 data set, automated data collection was carried out using Leginon v3.463 at a nominal magnification of 105,000× with a pixel size of 0.843 Å and stage tilt angle of 0° and 30°. 6,487 micrographs were collected with a defocus range comprised between −0.5 and −2.5 μm. For XBB.1 RBD–ACE2–S309 complex, samples were prepared using a Vitrobot Mark IV (Thermo Fisher Scientific) with R 2/2 UltrAuFoil grids and a Chameleon (SPT Labtech) with self-wicking nanowire Cu R1.2/0.8 holey carbon grids. For XBB.1 RBD–ACE2-S309 data set, 6,355 micrographs from UltrAuFoil grids were collected with a defocus range comprised between −0.2 and −3 μm and stage tilt angle of 0° and 30° and 2,889 micrographs from chameleon grids were collected with a defocus range comprised between −0.2 and −3 μm without tilting the stage. For BN.1 RBD–ACE2–S309 complex, samples were prepared using a Vitrobot Mark IV (Thermo Fisher Scientific) with R 2/2 UltrAuFoil grids, manual blotting/plunging with C-flat holey thick carbon grids and Chameleon (SPT Labtech) with self-wicking nanowire Cu R1.2/0.8 holey carbon grids. For BN.1 RBD–ACE2–S309 data set, 3,822 micrographs from UltrAuFoil grids, 2,000, micrographs from chameleon grids and 1,915 micrographs from C-flat holey thick carbon grids were collected with a defocus range comprised between −0.2 and −3.5 μm and stage tilt angle of 0° and 30°. The dose rate was adjusted to 15 counts per pixel per s, and each movie was acquired in super-resolution mode fractionated in 75 frames of 40 ms. Movie frame alignment, estimation of the microscope contrast transfer function parameters, particle picking, and extraction were carried out using Warp64 (v1.0.9).
Two rounds of reference-free 2D classification were performed using cryoSPARC65 (v4.2.2) to select well-defined particle images. These selected particles were subjected to two rounds of 3D classification with 50 iterations each (angular sampling 7.5° for 25 iterations and 1.8° with local search for 25 iterations) using Relion66,67 (v3.1) with an initial model generated with ab-initio reconstruction in cryoSPARC. 3D refinements were carried out using non-uniform refinement68 along with per-particle defocus refinement in CryoSPARC. Selected particle images were subjected to the Bayesian polishing procedure69 implemented in Relion before performing another round of non-uniform refinement in cryoSPARC followed by per-particle defocus refinement and again non-uniform refinement. To further improve the density of the BQ.1.1 RBD and XBB.1 RBD, the particles were subjected to focus 3D classification without refining angles and shifts using a soft mask encompassing the ACE2, RBD and S309 variable domains using a tau value of 60 in Relion. To further improve the density of the BN.1 RBD, the particles were subjected to cryoSPARC heterogeneous refinement. Particles belonging to classes with the best resolved local density were selected and subjected to non-uniform refinement using cryoSPARC. Local resolution estimation, filtering, and sharpening were carried out using CryoSPARC. Reported resolutions are based on the gold-standard Fourier shell correlation (FSC) with 0.143 criterion and Fourier shell correlation curves were corrected for the effects of soft masking by high-resolution noise substitution70,71.
Model building and refinement
UCSF Chimera72 (v1.17.1) and Coot73 (v0.9.6) were used to fit atomic models into the cryo-EM maps. RBD, ACE2 and S309 Fab models were refined and relaxed using Rosetta using sharpened and unsharpened maps74,75.
Statistical analysis
All statistical tests were performed as described in the indicated figure legends using Prism v9.1.0. The number of independent experiments performed are indicated in the relevant figure legends. Comparisons of means between multiple groups of unpaired data were made with Kruskal–Wallis rank test and corrected with Dunn’s test. Statistical significance is set as P < 0.05, and P values are indicated with: NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001, ****P < 0.0001. ED50, 80% of the maximum binding response (BD80), ID50 and IC50 titres were calculated from the interpolated value from the log(agonist) and the log(inhibitor), versus response using variable slope (four parameters) non-linear regression. Data were plotted and analysed with GraphPad Prism software (version 9.1.0).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.