Animal husbandry
Eight-week-old male and female C57BL/6 N mice were obtained from Envigo. Tlr9fl/fl (C57BL/6J-Tlr9em1Ldm/J) mice with loxP sites flanking exon 1 of the Tlr9, Ifnar1fl/fl (B6(Cg)-Ifnar1tm1.1Ees/J) mice with loxP sites flanking exon 3 of the type-1 interferon α/β receptor gene, Relafl/fl (B6.129S1-Relatm1Ukl/J) mice with loxP sites flanking exon 1 of the Rela gene, and Sting1-knockout mice C57BL/6J-Sting1gt/J; Goldenticket (Tmem173gt) mice were obtained from Jackson Laboratory and bred in institutional facilities. All mice were eight weeks of age at the beginning of experiments, unless otherwise specified. All mice were group housed (12 h:12 h light:dark cycle with lights on at 07:00, temperature 20–22 °C, humidity 30–60%) with ad libitum access to food and water (mice were switched to single housing one week before experiments). All experimental groups were mixed sex, consisting of approximately equal numbers of males and females. All procedures were approved by Northwestern University’s Animal Care and Use Committee (protocols IS00002463 and IS00003359) and Albert Einstein’s Animal Care and Use Committee (protocols 00001289 and 00001268) in compliance with US National Institutes of Health standards, and at Aarhus University in compliance with the Danish National Animal Experiment Committee (protocol 2021-15-0201-00801).
Tissue collection
For all analyses, mice were euthanized by cervical dislocation, dorsal hippocampi immediately dissected and frozen in liquid nitrogen. Frozen tissue was stored at −80 °C until protein or RNA extractions were performed.
Bulk RNA-seq
Read quality was assessed using FastQC46 (v0.10.1) to identify sequencing cycles with low average quality, adapter contamination, or repetitive sequences from PCR amplification. Alignment quality was analysed using SAMtools flagstat with default parameters. Data quality was visually inspected as described previously55. Furthermore, we assessed whether samples were sequenced deep enough by analysing the average per base coverage and the saturation correlation for all samples using the MEDIPS R package56. The saturation function splits each library in fractions of the initial number of reads (ten subsets of equal size) and plots the convergence. The correlation between biological replicates was evaluated using Pearson correlation (function MEDIPS.correlation). Only data passing all quality standards were used for further analyses. Data were aligned to the genome using gapped alignment as RNA transcripts are subject to splicing and reads might therefore span two distant exons. Reads were aligned to the whole Mus musculus mm10 genome using STAR aligner58 (2.3.0e_r291) with default options, generating mapping files (BAM format). Reads were aligned to mouse genome M. musculus mm10 and counted using FeaturesCount as described previously55. Genes with significantly different fold change (false discovery rate-corrected P < 0.05) were classified as up-regulated or down-regulated.
Isolation of nuclei and FACS
Fresh dorsal hippocampal tissue was collected from mice 96 h after CFC. Nuclei were isolated following an established protocol57. RNase inhibitor was added to the 6× homogenization buffer stable master mix at a final concentration of 1.2 U μl−1. Tissue was homogenized using a Polytron homogenizer for 1.5 min. Samples were resuspended with the 50% iodixanol solution (50% iodixanol in 1× homogenization buffer) via gentle pipetting to make a final concentration of 25% iodixanol. Three millilitres of a 35% iodixanol solution (35% iodixanol in 1× homogenization containing 480 mM sucrose) was added to a new 15 ml Falcon tube. Three millilitres of a 29% iodixanol solution (29% iodixanol in 1× homogenization buffer containing 480 mM sucrose) was layered above the 35% iodixanol mixture. A 4 ml 25% iodixanol solution was layered on the 29% solution. In a swinging-bucket centrifuge, nuclei were centrifuged for 20 min at 3,000g. After centrifugation, the nuclei were present at the interface of the 29% and 35% iodixanol solutions. This band with the nuclei was collected in a 300 μl volume and transferred to a pre-chilled tube. Following isolation, nuclei were counted and resuspended in fluorescence-activated cell sorting (FACS) buffer (1% BSA, 1 mM EDTA, and 0.2 U μl−1 RNase inhibitor in PBS) at 2 × 106 nuclei per ml. A subset of nuclei was sorted by GFP expression on a high-speed cell sorter flow cytometer (Beckman Coulter MoFlowXDP cell sorter). See Supplementary Fig. 1 for the detailed gating strategy.
snRNA-seq
snRNA-seq libraries were generated from up to 10,000 individual cells captured in an oil emulsion on a Chromium Controller (10x Genomics). cDNA was generated in the individual cell–gel bead emulsion micro-reactors while adding barcodes at the cellular and molecular level using the Chromium Next GEM Single Cell 3′ Kit v3.1(10x Genomics kit 1000268). The barcoded cDNAs from the individual cells were combined for the remaining library process. The unique molecular barcodes (UMIs) prevented amplification artefacts from skewing the analysis. The libraries were analysed on a Fragment Analyzer 5200 (Agilent Technologies) to ensure a normal size distribution with an average size of 450 bp and sequenced on an llumina Sequencer with the following read lengths: 28 bp for read 1, 10 bp for i7 index, 10 bp for i5 index and 90 bp for read 2 at a read depth of 20,000 reads per cell. Five libraries were generated and analysed (Supplementary Table 6).
snRNA-seq analysis
The sequencing files in FASTQ format of each sample were aligned against mouse mm10 genome v4.0.0 and converted to gene count matrices using Cellranger software v7.0.1. Quality control and downstream analysis was performed using Seurat R package v4.3.0. Doublets were detected and removed using R package scDblFinder v1.13.13. Ambient RNA was detected and corrected using R package SoupX v1.6.2. Cells with less than 1000 detected genes, more than 4,000 detected genes, or more than 5% mitochondrial genes were excluded from further analysis. Samples were normalized using Seurat SCTransform function and then integrated and clustered using Seurat functions. Differential gene expression analysis was performed to compare cells from different samples in each cluster. Genes with more than 1.5-fold change and an adjusted P value of less than 0.01 were defined as significant. Co-expression of two genes was assessed by comparing the cosine similarity of the target two genes and random chosen pair of genes. Gene set enrichment analysis was run on each cluster comparing samples with different condition against the Gene Ontology database using R package fgsea v1.20.0. Pathways with less than 0.05 adjusted P value are considered significantly enriched. The pathway analysis was performed using the Reactome Patway database (version 86)58. Well-established markers for brain and blood-derived cell populations were used to define individual clusters59,60.
Gene ontology and interaction network analyses of bulk RNA-seq data
Functional protein association network analysis was performed using Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (version 11.0)61 for up-regulated genes. The network was processed applying kmeans clustering, setting cluster number to 4. Inflammatory response-associated genes were identified using Mouse Genome Database (MGI) Batch Query Genome Analysis Tool (v6.23). Selection criteria was classification within the GO term ‘Inflammatory response’ (ID: GO:0006954) using IMP (Inferred from mutant phenotype), IEA (Inferred from electronic annotation) and IBA (Inferred from biological aspect of ancestor) evidence codes. Functional classification of up-regulated genes was performed using PANTHER Classification System engine, version 17.0. Genes were analysed through PANTHER Overrepresentation (test type: Fisher; correction: FDR; functional classification: PANTHER GO-Slim Biological Process, Mus musculus – REFLIST (21997)).
RT2 array
Differential expression of inflammatory response-associated genes between recent and remote memory was analysed using The Mouse Innate and Adaptive Immune Responses RT² Profiler PCR Array (Qiagen, 330231 PAMM-052ZA), according to manufacturer’s instructions. Total RNA was extracted from dorsal hippocampi using PureLink RNA Mini Kit (ThermoFisher, 12183018 A). Tissue was dissected either 96 h (n = 5, pooled) or 21 days (n = 5, pooled) after CFC, resuspended in lysis buffer, flash frozen in liquid nitrogen and stored at −80 °C. RNA was extracted following manufacturer’s instructions. cDNA was synthetized using the RT2 First Strand Kit (Qiagen, 330401). For each experimental group, 500 µg of total RNA was used for the cDNA synthesis. Genomic DNA elimination reaction was prepared by mixing RNA with 2 µl of buffer GE in 10 µl total reaction volume. Real-time PCR reaction was performed using RT2 SYBR Green qPCR Mastermix in duplicates for each sample (recent, remote). The PCR reaction was performed in an Applied Biosystems 7300 Real-Time PCR System with the following cycling conditions: 95 °C, 10 min; then 40 cycles of 95 °C, 15 s; 60 °C, 1 min. ΔCt values for each gene were calculated by subtracting the average Ct value of 6 housekeeping genes from the Ct value of each target gene. Differential expression between recent and remote memory was calculated from ΔΔCt value.
Quantitative PCR analysis
Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, 74136). Reverse transcription was performed on 100 ng of total RNA PrimeScript RT Reagent Kit (Takara RR037A). Real-time PCR analysis was performed on a QuantStudio 6 Flex instrument (ThermoFisher) using SYBR green detection system (Applied Biosystems, 4367659) and primers specific for Tlr9 (330001/PPM04221A-200), Tlr7 (330001/PPM04208A-200) and Tlr13 (330001/PPM41490A-200) (all from Qiagen). Housekeeping genes Gapdh and Hprt were used for normalization. ΔCt for target genes was calculated using average Ct of the two housekeeping genes. mRNA amount for each experimental group was expressed relative to naive group and calculated as ({2}^{Delta {C}_{{rm{t}}}-Delta {C}_{{{rm{t}}}_{naive}}}).
Cytosolic DNA extraction and analysis
Cytosolic DNA extraction was performed as previously described62. DNA was extracted using Mitochondria/Cytosol Fractionation Kit (Abcam, ab65320) from fresh tissue (dorsal hippocampus) and cleared extracts were treated with 1 mg ml−1 proteinase K for 1 h at 55 °C, extracted with phenol:chloroform, treated with RNase A (1 mg ml−1) for 1.5 h at 37 °C, and sequentially extracted with phenol:chloroform and chloroform. Purified cytosolic DNA was tested for nuclear DNA contamination by performing a 40-cycle PCR reaction using primers for vGlut1 (also known as Slc17a7) (forward: GTGGAAGTCCTGGAAACTGC, reverse: ATGAGCGAGGAGAATGTGG). For cloning of dsDNA, samples were treated with DNA polymerase I, large (Klenow) fragment (1 U µg−1 DNA; NEB), supplemented with 33 µM of each dNTP, for 15 min. DNA was precipitated with sodium acetate/ethanol as described above, and dissolved in water. DNA samples were treated with Taq polymerase (NEB) for 20 min, and immediately cloned into pCR4-TOPO vector (Invitrogen), according to manufacturer’s instructions. One Shot competent cells were transformed by adding 2 μl of the TOPO Cloning reaction into a vial of One Shot chemically competent Escherichia coli. Cells were incubated on ice for 30 min, heat-shocked for 30 s at 42 °C without shaking, and immediately transferred to ice. After 5 min, 250 μl of room temperature SOC medium was added, and tubes were placed horizontally in a shaker (200 rpm) at 37 °C for 1 h. Cells were pelleted at 6,000 rpm for 10 min, resuspended in 50 µl of SOC medium, and spread on a pre-warmed selective plate. Plates were incubated at 37 °C overnight. All colonies from each plate were picked and placed into individual wells of a 96-well plate containing 50 µl of PBS. The sequence of cloned DNA fragments was determined by direct colony sequencing (ACGT).
Primary cultures, treatment and live imaging
The hippocampi from post-natal day 0 (P1) C57BL/6 N male and female mice were isolated, and dissociated, as described previously63. Cells were plated in a 14-mm-diameter glass dish (MatTek, P35G-1.5-14-C) coated with poly-d-lysine (Sigma-Aldrich) at a density of 50,000 cells per cm2 and grown in neuronal medium (Neurobasal Medium containing 1 mM GlutaMax, and 2% B27, all from ThermoFisher). Neurons were cultured for 14 days in vitro before treatments. Cells were treated with 25 μM N-methyl-d-aspartate (NMDA) for 10 min in fresh neuronal medium, washed twice, and incubated for 1 h with PicoGreen (dsDNA dye, 1:20,000), CellMAsk (cell membrane dye, 1:1,000), and MitoTracker (mitochondria dye, 1:20,000) diluted in neuronal medium. Cells were imaged on Nikon W1 spinning disc confocal microscope (Center for Advanced Microscopy, Northwestern University), 1 frame per 10 s at 100× magnification.
Immunohistochemistry
Mice were anaesthetized with an intraperitoneal injection of 240 mg kg−1 Avertin and transcardially perfused with ice-cold 4% paraformaldehyde in phosphate buffer (pH 7.4, 150 ml per mouse). Brains were removed and post-fixed for 24 h in the same fixative and then immersed for 24 h each in 20% and 30% sucrose in phosphate buffer. Brains were frozen and 50-μm sections were cut for use in free-floating immunohistochemistry17 with the primary and secondary antibodies listed in Supplementary Tables 7 and 8, respectively. In addition to manufacturers’ validation, all primary antibodies were validated by comparison to no primary control samples.
PNN imaging
PNNs were visualized using Wisteria floribunda lectin (WFA) staining, a widely used approach for PNN visualization40. WFA staining was performed according to the manufacturer’s instructions. In brief, endogenous peroxidase was inactivated with hydrogen peroxide. Following streptavidin/biotin and Carbo-Free blocking, sections were incubated with biotinylated WFA (Vector Biolaboratories), Vectastain ABC system, and fluorescein, coumarin or rhodamine isothiocyanate (Akoya Biosciences). Sections were mounted using FluorSave (Millipore-Sigma).
Microscopy, image analysis and quantification
Low-magnification images (up to 60× magnification) were captured with a Leica microscope with a Leica DFC450 C digital camera whereas high-magnification images and z-stacks (60–100× magnification) were captured using a confocal laser-scanning microscope (Olympus Fluoview FV10i). All quantifications were performed with ImageJ. Clusters of γH2AX-positive neurons were first identified, and analyses were performed in the surrounding (~100 µm × 100 µm) area. Thus, the numbers are representative of regions of interest rather than average of the CA1 subfield. For time-course analyses, we counted γH2AX neurons in 180 neurons per mouse (3 consecutive slices of 60 neurons). With 6 mice per group, this amounted to 1,000 neurons per time point. In most of the other molecular targets we counted 60 neurons per mouse using a 60–100× objective. All images were converted to binary format, and for each cell showing γH2AX we determined the background and applied a threshold twice above the background signal. We thus obtained similar results across different antibodies and conditions. All analyses were performed with Fiji/ImageJ. The JACoP Plugin for object-based co-localization was used to determine co-localization by comparing the position of the centroids of the nuclei of the colour channels. Their respective coordinates were then used to define structures separated by distances equal to or below the optical resolution45. Volume and 3D viewer Plugins were used for 3D reconstruction of z-stacks, whereas plot profile and surface plot functions were used for analyses of clusters at lower (40×) magnification. Coloc2 was used to determine correlation of expression levels of different fluorophore signals. The analyse particles, plot profile and measure functions were used to determine the number, size, distribution and distance between indicated signals.
Fluorescent multiplex v2 RNAscope
Naive mice (n = 4) or mice subjected to CFC (n = 4) were perfused 96 h later with ice-cold 0.1 M PBS and 4% paraformaldehyde in PBS and processed as described above. RNAscope was performed according to the manufacturer instructions. To visualize Hsp90b1 and Dcx mRNA and NeuN protein RNAscope Multiplex Fluorescent Reagent Kit v2 (ACD Biotechne, 323100) and RNA–Protein Co-Detection Ancillary kit (ACD Biotechne, 323180) were used. In brief, slides were dried at 60 °C in an oven for 30 min, dehydrated in ethanol, treated with hydrogen peroxide for 10 min at room temperature, washed in water and boiled in co-detection target retrieval reagent (around 98 °C) for 5 min. The sections were incubated with anti-Neun antibody (1:500, Sigma, ABN78), fixed with 10% Neutral Buffered Formalin (VWR, GEN0786-1056), protease plus, and rinsed with sterile water. The hybridization step was performed by incubating the sections with the following probes: Mm-Hsp90b1-C1 (ACD Biotechne, 556051), Mm-DCX-C2 (ACD Biotechne, 478671-C2), Mm-PPIB (positive control probe, ACD Biotechne, 320881) and dabB (negative control probe, ACD Biotechne, 320871) for 2 h at 40 °C and stored overnight in 5× saline sodium citrate. The hybridization was amplified with AMP 1 and AMP 2. All amplification and development were performed at 40 °C, and 2 × 2 min of washes in ACD wash buffer was performed after each step. For C1 probe TSA Vivid Fluorophore Kit 520 (Biotechne, 7523) was used, for C2 and C3, positive and negative probes TSA Vivid Fluorophore Kit 650 (7527) was used. Sections were incubated with goat anti-rabbit Alexa-568 secondary antibody (1:300, Invitrogen, A11036) and DAPI solution (ACD bio), and mounted with Prolong Gold Antifade Mountant (ThermoFisher Scientific, 33342). Images were acquired with an Andor BC43 spinning disk confocal microscope (Oxford Instruments) controlled by the Fusion software from Andor, using a 10× air 0.45 NA objective, a 60× oil immersion 1.42 NA objective, a CMOS camera (6.5 μm pixel; 2,048 × 2,000 pixels generating 16-bit, monochrome images) with no binning. Samples were illuminated with 4 fixed wavelengths of 405 nm, 488 nm, 561 nm and 638 nm. Dorsal hippocampus overview was obtained with 3 × 3 stitching (10% overlap) using the 10× objective and the region of interest (CA1 pyramidal layer, closest to the midline) was afterward imaged at higher magnification using the 60× objective. Image analysis was performed after thresholding using the analyse particle function in ImageJ using four slices per mouse. The number of particles was analysed per 60 neurons per slice (240 neurons per mouse).
Fear conditioning
CFC was performed in an automated system (TSE Systems) as previously described29. In brief, mice were exposed for 3 min to a novel context, followed by a foot shock (2 s, 0.7 mA, constant current). TFC was performed by exposing the mice to for 3 min to a novel context, followed by a 30 s tone (75 dB SPL, 10 kHz, 200 ms pulse), a 15 s trace, and a foot shock (2 s, 0.7 mA, constant current)63. DFC was performed as described for TFC, except that trace was omitted so that shock immediately followed the end of the tone. At indicated time points, mice were tested for memory retrieval by re-exposing them to the same context (context test), or to a tone presented over 30 s in a different context (tone test after TFC or DFC). Testing consisted of 3 min in the conditioning context, during which freezing was measured every 10 s. Freezing was expressed as a percentage of the total number of observations during which the mice were motionless. Activity was recorded automatically by an infrared beam system and expressed in cm s−1. The individual experiments with wild-type mice were not performed on littermates, so we did not apply randomization procedures, but with all genetic lines bred in our facility, littermates were randomly assigned to different experimental groups to minimize litter effects. The behavioural tests were performed blindly, either by experimentalists who were unaware of the treatments because the solutions were coded or by experimenters unaware of the experimental design. The experimenter performing the tests was not aware of the numbering code.
Surgery and cannulation
Double-guided cannulas (Plastic One) were implanted in the dorsal hippocampus as described previously17. Mice were anesthetized with 1.2% tribromoethanol (vol/vol, Avertin) and implanted with bilateral 26-gauge cannulas using a stereotaxic apparatus (Kopf, model 1900). Stereotaxic coordinates for the dorsal hippocampus were 1.8 mm posterior, ±1.0 mm lateral and 2.0 mm ventral to bregma.
Pharmacological treatments
All oligonucleotides and drugs were injected into the dorsal hippocampus at a volume of 0.25 μl per side, at a rate of 0.15 μl min−1 using microinfusion pumps (Model UMP3T-1 UltraMicroPump 3 with SMARTouch Controller). ODN2088 was injected at doses of 125 and 300 ng per mouse corresponding to 4 and 8 nmol, respectively. Based on pilot experiments, the cGAS and STING antagonists were injected at doses of 10 and 50 ng in 250 nl per mouse.
DNase I (Sigma-Aldrich D4513, lot SLCQ3662, diluted in water) was injected intraperitoneally with 50 U DNase I in 200 µl saline, 24 h and 12 h before and 1 h after CFC, or intrahippocampally with 50 U DNase I per mouse at volume of 0.5 μl per side, at a rate of 1 μl min−1 24 h before and 1 h after test. DNase I and S1 nuclease (Thermo Scientific, EN0321) treatment were injected into the dorsal hippocampus at dosage 5 U DNase I + 10U S1 in 20% glycerol/artificial cerebrospinal fluid, vehicle: 20% glycerol/artificial cerebrospinal fluid 4 h before the memory test. Treatment schedules and doses were designed based on published data64 and including both high and low doses as well as pre-CFC and pre-test injections.
For depletion of microglia, Pexidartinib (PLX-3397, HY-16749 lot: 212013 MedChemExpress) was formulated into 5053 PicoLab Rodent Diet 20 at the concentration of 290 ppm (W.F. Fisher and Son). The mice were fed for four weeks before the test. LabDiet 5053 served as a control diet. At the end of experiments, all brains were collected for histological determination of cannula placements or immunohistochemistry.
Virus injections
All viruses (listed in Supplementary Table 9) were injected at a volume of 0.5 μl per side, 1.8 mm posterior, ±1.0 mm lateral and 2.0 mm ventral to bregma, at a rate of 0.15 μl min−1. At the time of virus infusion, mice were eight weeks old. CFC and memory tests were performed from weeks 13 to 17. One day after the completion of behavioural testing, mice were intracardially perfused, and all brains were collected, and virus spread was confirmed by immunohistochemical analysis of GFP or mCherry.
Labelling CFC-activated CA1 neurons using robust activity marking
We labelled the CA1 neurons in the dorsal hippocampus activated during CFC using doxycycline-off (off-Dox) activity-dependent cell tagging with the Robust Activity RAM system31 coupled to the human Fos minimal promoter with four tandem repeats of an enhancer module (PRAM) as recently described in detail11. In brief, we put two groups of wild-type mice on a doxycycline diet one day before injecting AAV2/9-PRAM:d2tTA-TRE:NLS-mKate2 and took them off the diet after 9 days, followed by CFC the day after. Mice were left undisturbed in our testing facility without doxycycline for additional two days. Following two days, mice were put back on the doxycycline diet and 96 h after CFC, one group was subjected to memory reactivation (context test) and euthanized 1 h later. An additional, non-reactivated group served as control. This later group was only used internally to ensure that there was no Fos response without memory reactivation.
Statistics and reproducibility
Statistical power to detect anticipated effect sizes was determined using power analysis (calculator at http://www.stat.ubc.ca/~rollin/stats/ssize/n2.html) conducted on representative samples of previous work and pilot experiments. For all proposed experiments, minimum power is set at 0.90 to detect an α = 0.05 (two-sided test) for a difference in means from 20% to 40%, with a 15% common standard deviation. To prevent litter effects, mice from the same litter were assigned to different experimental groups. Viruses were injected by experimenters aware of the construct but the mice were then assigned coded numbers by the laboratory technician. The code was available after quantification and before analyses. Statistical analyses were performed using GraphPad Prism. Mice with misplaced virus infusion or cannulas, and mice with less than 70% viral expression in the CA1 were excluded. One-way ANOVA followed by Tukey’s test was used for post hoc comparisons of three or more experimental groups (only when ANOVA was significant) whereas Student’s t-test was used for comparison of two experimental groups. Homogeneity of variance was confirmed with Levene’s test for equality of variances. On indicated data, we performed correlation analyses and report Pearson’s r coefficients. Significant changes of co-localization or activation (%) were determined using the Chi-square test. A priori determined post hoc analyses following Chi-square tests were performed using Bonferroni-corrected alpha levels as the original overall alpha level (α = 0.05) was divided by the number of tests being conducted. These adjusted alpha levels were used as the new significance threshold for each individual test. All comparisons were conducted using two-tailed tests and the P value for all cases was set to <0.05 for significant differences. Data are expressed as mean ± s.e.m. Statistically significant differences are indicated as *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 and *****P < 0.00001. All cellular and molecular effects were shown in a minimum of six biological replicates (Figs. 1e and 2e and Extended Data Figs. 3f and 9). Two experimental replicates were performed for all time-course, Tlr9-KO, Rela-KO, Ifnar1-KO and WT–cre experiments (Figs. 1c,d, 2a–d and 5a,c and Extended Data Figs. 2–4, 11 and 12). All significant behavioural effects were replicated at least three times using wild-type, virus-specific and cell-specific control groups. All main gene expression effects were replicated with four different approaches (bulk RNA-seq, quantitative PCR arrays, quantitative PCR and snRNA-seq). Replicates produced similar results relative to initial or representative experiments.
Figures
Figures were created and edited using Adobe Illustrator CS6 (Adobe, v27.5, RRID: SCR_010279). Figs. 1a, 1b, 2a, 2e, 3a, 3c, 3d, 4a, and 5a, as well as Extended Data Figs. 4c, 4d, 5a, 5b, 5c, 5d and Supplementary Fig. 1 were created using BioRender.com.
Ethics declaration
All animal procedures used in this study were approved by the Northwestern University IACUC, Albert Einstein Medical College IACUC and Danish National Animal Experiment Committee, and complied with federal regulations set forth by the National Institutes of Health.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.